pYPQ132B-TLS-PtALSgRNA
(Plasmid
#245881)
-
PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245881 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHD1
-
Backbone manufacturerCermak et al. 2011
- Total vector size (bp) 3660
-
Modifications to backboneInsertion of TLS2 mobile RNA sequence
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtALSgRNA
-
gRNA/shRNA sequencecaggttccgcggcgaatgat
-
SpeciesSynthetic
- Promoter AtU3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer tctgatgttacattgcacaaga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Addgene NGS sequence differs from the reference sequence attached: it is missing a section of backbone, but the depositor has confirmed this does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYPQ132B-TLS-PtALSgRNA was a gift from Yiping Qi (Addgene plasmid # 245881 ; http://n2t.net/addgene:245881 ; RRID:Addgene_245881) -
For your References section:
Transgene-free genome editing in citrus and poplar trees using positive and negative selection markers. Rocha DC, Omoregbee MO, Contiliani DF, Mandlik R, Li G, Mascoveto J, Coleman G, Culver JN, Leal DR, de Souza AA, Qi Y. Plant Cell Rep. 2025 Oct 22;44(11):244. doi: 10.1007/s00299-025-03627-2. 10.1007/s00299-025-03627-2 PubMed 41123679