Skip to main content

huCofilin S3E SSR
(Plasmid #245940)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 245940 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Unknown
  • Backbone size w/o insert (bp) 5428
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1 (cfl1)
  • Species
    H. sapiens (human)
  • Mutation
    S3E; silent mutations (NTs 67 to 75) in which TCTTCAACG is replaced with AGCTCAACC and NTs 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

S3A mutation means it is super resistent to cofilin shRNA. The silent mutations protect expression against two human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) that target different sequences in cofilin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    huCofilin S3E SSR was a gift from James Bamburg (Addgene plasmid # 245940 ; http://n2t.net/addgene:245940 ; RRID:Addgene_245940)
  • For your References section:

    Reactivation of phosphorylated actin depolymerizing factor and identification of the regulatory site. Agnew BJ, Minamide LS, Bamburg JR. J Biol Chem. 1995 Jul 21;270(29):17582-7. doi: 10.1074/jbc.270.29.17582. 10.1074/jbc.270.29.17582 PubMed 7615564