huCofilin S3E SSR
(Plasmid
#245940)
-
PurposeExpresses human cofilin with mutation S3E that behaves like inactive phosphocofilin but can be dominant negative against phosphatase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerUnknown
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecofilin 1 (cfl1)
-
SpeciesH. sapiens (human)
-
MutationS3E; silent mutations (NTs 67 to 75) in which TCTTCAACG is replaced with AGCTCAACC and NTs 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
-
Entrez GeneCFL1 (a.k.a. CFL, HEL-S-15, cofilin)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
S3A mutation means it is super resistent to cofilin shRNA. The silent mutations protect expression against two human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) that target different sequences in cofilin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
huCofilin S3E SSR was a gift from James Bamburg (Addgene plasmid # 245940 ; http://n2t.net/addgene:245940 ; RRID:Addgene_245940) -
For your References section:
Reactivation of phosphorylated actin depolymerizing factor and identification of the regulatory site. Agnew BJ, Minamide LS, Bamburg JR. J Biol Chem. 1995 Jul 21;270(29):17582-7. doi: 10.1074/jbc.270.29.17582. 10.1074/jbc.270.29.17582 PubMed 7615564