ADF shRNA mouse
(Plasmid
#245952)
-
PurposeFor making other mouse ADF silencing vectors
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 245952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript
-
Backbone manufacturerUnknown
- Backbone size w/o insert (bp) 2961
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameactin depolymerizing factor (ADF)
-
Alt namedestrin
-
gRNA/shRNA sequenceAAGTGATTGCAATCCGTGTAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneDstn (a.k.a. 2610043P17Rik, AD, ADF, AU042046, Dsn, co, corn1, sid, sid23p)
- Promoter pol III H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Silences mouse ADF but not cofilin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ADF shRNA mouse was a gift from James Bamburg (Addgene plasmid # 245952 ; http://n2t.net/addgene:245952 ; RRID:Addgene_245952)