Skip to main content

huCof WT SSR RedTrack
(Plasmid #245955)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 245955 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    RedTrack CMV
  • Backbone manufacturer
    James Bamburg (Addgene #50957)
  • Backbone size w/o insert (bp) 9081
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1 (cfl1)
  • Species
    H. sapiens (human)
  • Mutation
    silent mutations (NTs 67 to 75) in which TCTTCAACG is replaced with AGCTCAACC and NTs 206-218 in which CACTTTTGTCAAG is replaced with GACGTTTGTGAAA
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter CMV for huCof WT and separate CMV for mRFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)
  • 3′ cloning site Unspecified (unknown if destroyed)
  • 5′ sequencing primer Unspecified
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The silent mutations protect expression against two human shRNAs (CCACCTTTGTCAAGATGCT and AAGTCTTCAACGCCAGAGGAG) that target different sequences in cofilin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    huCof WT SSR RedTrack was a gift from James Bamburg (Addgene plasmid # 245955 ; http://n2t.net/addgene:245955 ; RRID:Addgene_245955)