huCof null + rat cof shRNA
(Plasmid
#245960)
-
PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepShuttle MCP
- Backbone size w/o insert (bp) 8507
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecofilin 1 (cfl1)
-
gRNA/shRNA sequenceAAGGTGTTCAATGACATGAAA
-
SpeciesH. sapiens (human)
-
Mutation_1-5, Y82F, KK95,96QQ
-
Entrez GeneCFL1 (a.k.a. CFL, HEL-S-15, cofilin)
- Promoter MCP for cofilin and pol III for shRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
huCof null + rat cof shRNA was a gift from James Bamburg (Addgene plasmid # 245960 ; http://n2t.net/addgene:245960 ; RRID:Addgene_245960)