Skip to main content

NSE-huCof K22Q + rat cof shRNA
(Plasmid #245962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 245962 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pShuttle NSE
  • Backbone size w/o insert (bp) 7981
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cofilin 1 (cfl1)
  • gRNA/shRNA sequence
    AAGGTGTTCAATGACATGAAA
  • Species
    H. sapiens (human)
  • Mutation
    K22Q
  • Entrez Gene
    CFL1 (a.k.a. CFL, HEL-S-15, cofilin)
  • Promoter NSE for cofilin K22Q and pol III for shRNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NSE-huCof K22Q + rat cof shRNA was a gift from James Bamburg (Addgene plasmid # 245962 ; http://n2t.net/addgene:245962 ; RRID:Addgene_245962)