pBOB-HA-Gnao1-A
(Plasmid
#245998)
-
PurposeExpress HA N-terminal tagged mouse GalphaoA transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBOB
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGnao1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1065
-
GenBank IDNM_010308
-
Entrez GeneGnao1 (a.k.a. Galphao, Gnao, Hg1g, alphaO)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATCG
- 3′ sequencing primer TACTCACCCCAACAGCTGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOB-HA-Gnao1-A was a gift from Zhao Zhang (Addgene plasmid # 245998 ; http://n2t.net/addgene:245998 ; RRID:Addgene_245998) -
For your References section:
GPR45 modulates Galpha(s) at primary cilia of the paraventricular hypothalamus to control food intake. Xun Y, Jiang Y, Xu B, Tang M, Ludwig S, Nakamura K, Mukhopadhyay S, Liu C, Beutler B, Zhang Z. Science. 2025 Jun 5;388(6751):eadp3989. doi: 10.1126/science.adp3989. Epub 2025 Jun 5. 10.1126/science.adp3989 PubMed 40472089