pDest_Tol2-gata2-hP1P2-eGFP
(Plasmid
#246039)
-
PurposeTol2 vector for enhancer-reporter assay in zebrafish for human Peak1-Peak2 region of the human EC1.45 enhancer cluster.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDest
- Total vector size (bp) 9972
-
Vector typeZebrafish Tol2 transgenesis for enhancer reporter assay
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman Peak1-Peak2 from EC1.45 enhancer cluster
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1616
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer gata2_seq_Rev CCTACTGCTCCACATCCAGA
- 3′ sequencing primer Peak1_seq_For CTGCTCCTTCTTCCAGGC; Peak1_seq_For2 GATTGAGAACAGGTGCAGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegata2 promoter
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1030
Gene/Insert 3
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDest_Tol2-gata2-hP1P2-eGFP was a gift from Hannah Long (Addgene plasmid # 246039)