Skip to main content

pRRL_LYSET_Y34X
(Plasmid #246084)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246084 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 8765
  • Total vector size (bp) 9161
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LYSET Y34X
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    396
  • GenBank ID
    NM_015676.3
  • Entrez Gene
    LYSET (a.k.a. C14orf109, DMAN, GCAF, TMEM251)
  • Promoter UBC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTAAGTAGCTGAAGCTCCG
  • 3′ sequencing primer GGGACTTTCCACACCCTAACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL_LYSET_Y34X was a gift from Wilhelm Palm (Addgene plasmid # 246084 ; http://n2t.net/addgene:246084 ; RRID:Addgene_246084)
  • For your References section:

    Lysosomal enzyme trafficking factor LYSET enables nutritional usage of extracellular proteins. Pechincha C, Groessl S, Kalis R, de Almeida M, Zanotti A, Wittmann M, Schneider M, de Campos RP, Rieser S, Brandstetter M, Schleiffer A, Muller-Decker K, Helm D, Jabs S, Haselbach D, Lemberg MK, Zuber J, Palm W. Science. 2022 Oct 7;378(6615):eabn5637. doi: 10.1126/science.abn5637. Epub 2022 Oct 7. 10.1126/science.abn5637 PubMed 36074822