Skip to main content

pEYFP-C1-PHF13
(Plasmid #246098)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246098 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEYFP_C1_A206K
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHF13
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    903
  • Entrez Gene
    PHF13 (a.k.a. PHF5, SPOC1)
  • Tag / Fusion Protein
    • mEYFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEYFP-C1-PHF13 was a gift from Sarah Kinkley (Addgene plasmid # 246098 ; http://n2t.net/addgene:246098 ; RRID:Addgene_246098)
  • For your References section:

    Differential oligomerization regulates PHF13 chromatin affinity and function. Rossi F, Magalhaes AP, Buschow R, Schubert T, Glaser L, Fontana A, Mai J, Staege H, Grimme A, Will H, Schriener S, Hnisz D, Vingron M, Chiariello AM, Kinkley S. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf572. doi: 10.1093/nar/gkaf572. 10.1093/nar/gkaf572 PubMed 40598901