Skip to main content
Addgene
Open Menu

pEYFP-C1-PHF13_NTD (21-70)
(Plasmid #246099)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246099 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pEYFP_C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHF13_NTD ( aa 21-70)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    156
  • Mutation
    aa 21 - 70
  • Entrez Gene
    PHF13 (a.k.a. PHF5, SPOC1)
  • Tag / Fusion Protein
    • mEYFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEYFP-C1-PHF13_NTD (21-70) was a gift from Sarah Kinkley (Addgene plasmid # 246099 ; http://n2t.net/addgene:246099 ; RRID:Addgene_246099)

  • For your References section:

    Differential oligomerization regulates PHF13 chromatin affinity and function. Rossi F, Magalhaes AP, Buschow R, Schubert T, Glaser L, Fontana A, Mai J, Staege H, Grimme A, Will H, Schriener S, Hnisz D, Vingron M, Chiariello AM, Kinkley S. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf572. doi: 10.1093/nar/gkaf572. 10.1093/nar/gkaf572 PubMed 40598901
Related items: