pEYFP-C1-PHF13∆NTD (del21-70)
(Plasmid
#246100)
-
PurposeExpression of human PHF13 with N terminal domain deletion fused to mEYFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEYFP_C1_A206K
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePHF13∆NTD (del21-70)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)753
-
Mutationdel aa 21 - 70 , K20E
-
Entrez GenePHF13 (a.k.a. PHF5, SPOC1)
-
Tag
/ Fusion Protein
- mEYFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTG
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEYFP-C1-PHF13∆NTD (del21-70) was a gift from Sarah Kinkley (Addgene plasmid # 246100 ; http://n2t.net/addgene:246100 ; RRID:Addgene_246100) -
For your References section:
Differential oligomerization regulates PHF13 chromatin affinity and function. Rossi F, Magalhaes AP, Buschow R, Schubert T, Glaser L, Fontana A, Mai J, Staege H, Grimme A, Will H, Schriener S, Hnisz D, Vingron M, Chiariello AM, Kinkley S. Nucleic Acids Res. 2025 Jun 20;53(12):gkaf572. doi: 10.1093/nar/gkaf572. 10.1093/nar/gkaf572 PubMed 40598901