Skip to main content

p305N-5
(Plasmid #246288)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246288 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p305N
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtU6.1m2 promoter
  • gRNA/shRNA sequence
    CATGCCCGAAGGCTACGTCC
  • Species
    A. thaliana (mustard weed)
  • Mutation
    A-to-C (-63 from TSS) and G-to-T (-57) within USE
  • Promoter AtU6.1m2 promoter

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds a ~1.2kb insertion that adds a transposable element to the plasmid (WP_010723085.1).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p305N-5 was a gift from Chung-Jui Tsai (Addgene plasmid # 246288 ; http://n2t.net/addgene:246288 ; RRID:Addgene_246288)
  • For your References section:

    A compendium of nonredundant short polymerase III promoters for CRISPR applications. Deguchi M, Sinclair KM, Patel A, Coile M, Ortega MA, Bewg WP, Tsai CJ. Plant Physiol. 2025 Jul 3;198(3):kiaf294. doi: 10.1093/plphys/kiaf294. 10.1093/plphys/kiaf294 PubMed 40673482