p305N-9 (nonfunctional)
              
              
                (Plasmid
                
                #246292)
              
            
            
            
          - 
            PurposeEvaluation of AtU6.29c13 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter line
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonep305N
- 
              Vector typePlant Expression, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameAtU6.29c13 promoter (nonfunctional)
- 
                    gRNA/shRNA sequenceCATGCCCGAAGGCTACGTCC
- 
                    SpeciesA. thaliana (mustard weed)
- 
                  Mutationdeletions: -A (-58 from TSS), -T (-57) within USE
- Promoter AtU6.29c13 promoter (nonfunctional)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: p305N-9 (nonfunctional) was a gift from Chung-Jui Tsai (Addgene plasmid # 246292 ; http://n2t.net/addgene:246292 ; RRID:Addgene_246292)
- 
                For your References section: A compendium of nonredundant short polymerase III promoters for CRISPR applications. Deguchi M, Sinclair KM, Patel A, Coile M, Ortega MA, Bewg WP, Tsai CJ. Plant Physiol. 2025 Jul 3;198(3):kiaf294. doi: 10.1093/plphys/kiaf294. 10.1093/plphys/kiaf294 PubMed 40673482
