p305N
(Plasmid
#246316)
-
PurposeA promoterless construct designed for cloning various Pol III promoters or serving as a control in evaluating Pol III promoters for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep304N
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoterless
-
gRNA/shRNA sequenceCATGCCCGAAGGCTACGTCC
-
SpeciesOther
- Promoter Promoterless
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p305N was a gift from Chung-Jui Tsai (Addgene plasmid # 246316 ; http://n2t.net/addgene:246316 ; RRID:Addgene_246316) -
For your References section:
A compendium of nonredundant short polymerase III promoters for CRISPR applications. Deguchi M, Sinclair KM, Patel A, Coile M, Ortega MA, Bewg WP, Tsai CJ. Plant Physiol. 2025 Jul 3;198(3):kiaf294. doi: 10.1093/plphys/kiaf294. 10.1093/plphys/kiaf294 PubMed 40673482