pRSET-bfrb
(Plasmid
#246325)
-
PurposeMycobacterium tuberculosis ferritin BfrB expression plasmid for E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSET A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacterioferritin
-
Alt nameBfrB
-
SpeciesMycobacterium tuberculosis
-
Insert Size (bp)555
-
GenBank ID
-
Entrez GenebfrB (a.k.a. Rv3841)
- Promoter T7 promoter
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GCTGATACCGCTCGCCGCAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET-bfrb was a gift from Ye Gao (Addgene plasmid # 246325 ; http://n2t.net/addgene:246325 ; RRID:Addgene_246325) -
For your References section:
Mycobacterium tuberculosis ferritin: a suitable workhorse protein for cryo-EM development. Gijsbers A, Zhang Y, Gao Y, Peters PJ, Ravelli RBG. Acta Crystallogr D Struct Biol. 2021 Aug 1;77(Pt 8):1077-1083. doi: 10.1107/S2059798321007233. Epub 2021 Jul 29. 10.1107/S2059798321007233 PubMed 34342280