NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
(Plasmid
#246438)
-
PurposeAll-in-one plasmid. Expresses R-NmeCas9 in mammalian cells for RNA knockdown. Spacer targeting EZH2 gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSimpleII
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameNmeCas9
-
SpeciesNeisseria meningitidis, strain 8013
-
Insert Size (bp)2931
-
Mutationchanged Aspartic acid 16 to Alanine, deleted amino acids 951-1059
-
GenBank IDFM999788.1 19818133
- Promoter EF-1 alpha
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- HA tag (C terminal on insert)
- NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gctgccttcaaacctaattcaatcaactacatcctc
- 3′ sequencing primer acggacaggcgggcgttttttca
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNme-sgRNA
-
SpeciesNeisseria meningitidis, strain 8013
-
Insert Size (bp)156
-
Mutationfusion of repeat/tracrRNA to make a sgRNA
-
GenBank IDFM999788.1
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gagcagatactggcttaactatg
- 3′ sequencing primer aaataaacaaataggggttccgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide was a gift from Ailong Ke (Addgene plasmid # 246438 ; http://n2t.net/addgene:246438 ; RRID:Addgene_246438) -
For your References section:
Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585