Skip to main content

NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
(Plasmid #246438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246438 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSimpleII
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    NmeCas9
  • Species
    Neisseria meningitidis, strain 8013
  • Insert Size (bp)
    2931
  • Mutation
    changed Aspartic acid 16 to Alanine, deleted amino acids 951-1059
  • GenBank ID
    FM999788.1 19818133
  • Promoter EF-1 alpha
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • HA tag (C terminal on insert)
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctgccttcaaacctaattcaatcaactacatcctc
  • 3′ sequencing primer acggacaggcgggcgttttttca
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nme-sgRNA
  • Species
    Neisseria meningitidis, strain 8013
  • Insert Size (bp)
    156
  • Mutation
    fusion of repeat/tracrRNA to make a sgRNA
  • GenBank ID
    FM999788.1
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagcagatactggcttaactatg
  • 3′ sequencing primer aaataaacaaataggggttccgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide was a gift from Ailong Ke (Addgene plasmid # 246438)
  • For your References section:

    Conversion of IscB and Cas9 into RNA-guided RNA editors. Xu C, Niu X, Sun H, Yan H, Tang W, Ke A. Cell. 2025 Aug 18:S0092-8674(25)00854-2. doi: 10.1016/j.cell.2025.07.032. 10.1016/j.cell.2025.07.032 PubMed 40829585