yEPAC-R279L pDRF1-GW
(Plasmid
#246454)
-
PurposeExpresses the non-responsive yEPAC-R279L sensor in budding yeast.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDRF1-GW
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyEPAC-R269L
-
SpeciesSynthetic
-
Insert Size (bp)4335
- Promoter PMA1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Non-responsive yEPAC sensor, which itself can be found at https://www.addgene.org/191449/ (named Epac-SH225).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
yEPAC-R279L pDRF1-GW was a gift from Bas Teusink (Addgene plasmid # 246454 ; http://n2t.net/addgene:246454 ; RRID:Addgene_246454) -
For your References section:
A yeast FRET biosensor enlightens cAMP signaling. Botman D, O'Toole TG, Goedhart J, Bruggeman FJ, van Heerden JH, Teusink B. Mol Biol Cell. 2021 Jun 15;32(13):1229-1240. doi: 10.1091/mbc.E20-05-0319. Epub 2021 Apr 21. 10.1091/mbc.E20-05-0319 PubMed 33881352