pET-28a(+) PCMT1 H58 A214
              
              
                (Plasmid
                
                #246496)
              
            
            
            
          - 
            PurposeRecombinant protein expression of PCMT1 H58 A214
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepET-28a(+)
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6045
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
              Growth instructionsExpress in BL21(DE3)
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameProtein-L-isoaspartate(D-aspartate) O-methyltransferase 1
- 
                  Alt namePCMT1
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)687
- 
                  MutationThreonine 58 mutated to Histidine and Valine 214 mutated to Alanine
- 
                    GenBank ID
- 
                        Entrez GenePCMT1 (a.k.a. PIMT)
- Promoter T7
- 
    
        Tag
        / Fusion Protein
    - His-tag (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            A portion of this plasmid was derived from a plasmid made byProduced for us in this study by Twist Bioscience using our order specifications
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Induce with 1 mM IPTG after growth at 37°C to an OD600 ~ 0.6 - 0.8; then express overnight at 37°C.
Please visit https://doi.org/10.1101/2025.05.21.654933 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pET-28a(+) PCMT1 H58 A214 was a gift from Steven Clarke (Addgene plasmid # 246496 ; http://n2t.net/addgene:246496 ; RRID:Addgene_246496)
- 
                For your References section: Structural basis for L-isoaspartyl-containing protein recognition by the PCMTD1 cullin-RING E3 ubiquitin ligase. Pang EZ, Zhao B, Flowers C, Oroudjeva E, Winter JB, Pandey V, Sawaya MR, Wohlschlegel J, Loo JA, Rodriguez JA, Clarke SG. bioRxiv [Preprint]. 2025 May 21:2025.05.21.654933. doi: 10.1101/2025.05.21.654933. 10.1101/2025.05.21.654933 PubMed 40475564
