Skip to main content

pET-28a(+) PCMT1 H58 A214
(Plasmid #246496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246496 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a(+)
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6045
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Express in BL21(DE3)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Protein-L-isoaspartate(D-aspartate) O-methyltransferase 1
  • Alt name
    PCMT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    687
  • Mutation
    Threonine 58 mutated to Histidine and Valine 214 mutated to Alanine
  • GenBank ID
  • Entrez Gene
    PCMT1 (a.k.a. PIMT)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Produced for us in this study by Twist Bioscience using our order specifications

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Induce with 1 mM IPTG after growth at 37°C to an OD600 ~ 0.6 - 0.8; then express overnight at 37°C.

Please visit https://doi.org/10.1101/2025.05.21.654933 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a(+) PCMT1 H58 A214 was a gift from Steven Clarke (Addgene plasmid # 246496 ; http://n2t.net/addgene:246496 ; RRID:Addgene_246496)
  • For your References section:

    Structural basis for L-isoaspartyl-containing protein recognition by the PCMTD1 cullin-RING E3 ubiquitin ligase. Pang EZ, Zhao B, Flowers C, Oroudjeva E, Winter JB, Pandey V, Sawaya MR, Wohlschlegel J, Loo JA, Rodriguez JA, Clarke SG. bioRxiv [Preprint]. 2025 May 21:2025.05.21.654933. doi: 10.1101/2025.05.21.654933. 10.1101/2025.05.21.654933 PubMed 40475564