Skip to main content

pX459-Fzd9 gRNA
(Plasmid #246551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX459
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fzd9 gRNA
  • gRNA/shRNA sequence
    GTTCTGGTCTCGGCGCGATA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Fzd9 (a.k.a. mfz9)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic oligo

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CBh-SpCas9-T2A-Puro cassette on backbone

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-Fzd9 gRNA was a gift from Mario Vallon (Addgene plasmid # 246551 ; http://n2t.net/addgene:246551 ; RRID:Addgene_246551)
  • For your References section:

    WNT7A/B assemble a GPR124-RECK-LRP5/6 co-receptor complex to activate beta-catenin signaling in brain endothelial cells. Heiden R, Hannig L, Kuo CJ, Ergun S, Braunger BM, Vallon M. J Biol Chem. 2025 Sep 4:110682. doi: 10.1016/j.jbc.2025.110682. 10.1016/j.jbc.2025.110682 PubMed 40914247