pX459-Itga5 gRNA
(Plasmid
#246573)
-
PurposeCRISPR vector co-expressing Cas9 and a mouse Itga5 gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameItga5 gRNA
-
gRNA/shRNA sequenceCTTTCTACAGATCTAATCGT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneItga5 (a.k.a. Cd49e, Fnra, VLA5)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic oligo
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CBh-SpCas9-T2A-Puro cassette on backbone
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-Itga5 gRNA was a gift from Mario Vallon (Addgene plasmid # 246573 ; http://n2t.net/addgene:246573 ; RRID:Addgene_246573) -
For your References section:
WNT7A/B assemble a GPR124-RECK-LRP5/6 co-receptor complex to activate beta-catenin signaling in brain endothelial cells. Heiden R, Hannig L, Kuo CJ, Ergun S, Braunger BM, Vallon M. J Biol Chem. 2025 Sep 4:110682. doi: 10.1016/j.jbc.2025.110682. 10.1016/j.jbc.2025.110682 PubMed 40914247