pX459-Itgb1 gRNA
(Plasmid
#246577)
-
PurposeCRISPR vector co-expressing Cas9 and a mouse Itgb1 gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX459
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameItgb1 gRNA
-
gRNA/shRNA sequenceAATGTCACCAATCGCAGCAA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneItgb1 (a.k.a. 4633401G24Rik, CD29, Fnrb, Gm9863, gpIIa)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic oligo
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CBh-SpCas9-T2A-Puro cassette on backbone
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-Itgb1 gRNA was a gift from Mario Vallon (Addgene plasmid # 246577 ; http://n2t.net/addgene:246577 ; RRID:Addgene_246577) -
For your References section:
WNT7A/B assemble a GPR124-RECK-LRP5/6 co-receptor complex to activate beta-catenin signaling in brain endothelial cells. Heiden R, Hannig L, Kuo CJ, Ergun S, Braunger BM, Vallon M. J Biol Chem. 2025 Sep 4:110682. doi: 10.1016/j.jbc.2025.110682. 10.1016/j.jbc.2025.110682 PubMed 40914247