Skip to main content
Addgene
Open Menu

pGGA-FT guide RNA1_7
(Plasmid #246797)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246797 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pGGA000
  • Backbone size w/o insert (bp) 2686
  • Vector type
    Plant Expression, CRISPR ; GreenGate cloning entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3-
  • Alt name
    AtU6-29 promoter-FT guide RNA2-AtU6-29 promoter-FT guide RNA4-
  • Alt name
    AtU3b promoter-FT guide RNA5-AtU3b promoter-FT guide RNA6-AtU3d promoter-FT guide RNA7
  • gRNA/shRNA sequence
    acccgagttaatgcaaatcc, tggttaaaaatgccccacgc, CTCTTTGGCCATAAGTAAC, ttaagatactctctgctata, CCGAGAATATCTCCATTGgt, TGCTACAACTGGAACAACCt, CGGGAAGGCCGAGATTGTAG
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    3069
  • Entrez Gene
    FT (a.k.a. AT1G65480, F5I14.3, F5I14_3, FLOWERING LOCUS T, REDUCED STEM BRANCHING 8, RSB8)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer atgtgagttagctcactcattaggcac
  • 3′ sequencing primer gcaaggcgattaagttgggtaacg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGGA-FT guide RNA1_7 was a gift from Danhua Jiang (Addgene plasmid # 246797 ; http://n2t.net/addgene:246797 ; RRID:Addgene_246797)
Related items: