Skip to main content

pGGC-AtUBQ10 promoter-Insulator
(Plasmid #246799)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246799 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGGC000
  • Backbone size w/o insert (bp) 2686
  • Vector type
    GreenGate cloning entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtUBQ10 promoter-Insulator
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    4036

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer atgtgagttagctcactcattaggcac
  • 3′ sequencing primer gcaaggcgattaagttgggtaacg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGGC-AtUBQ10 promoter-Insulator was a gift from Danhua Jiang (Addgene plasmid # 246799 ; http://n2t.net/addgene:246799 ; RRID:Addgene_246799)