pGGE-AtCLF
(Plasmid
#246806)
-
PurposeA GreenGate entry vector containing coding region of AtCLF
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGGE000
- Backbone size w/o insert (bp) 2686
-
Vector typeGreenGate cloning entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtCLF
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2708
-
Entrez GeneCLF (a.k.a. AT2G23380, CURLY LEAF, F26B6.3, F26B6_3, ICU1, INCURVATA 1, SDG1, SET1, SETDOMAIN 1, SETDOMAIN GROUP 1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer atgtgagttagctcactcattaggcac
- 3′ sequencing primer gcaaggcgattaagttgggtaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGGE-AtCLF was a gift from Danhua Jiang (Addgene plasmid # 246806 ; http://n2t.net/addgene:246806 ; RRID:Addgene_246806)