pGGF-NLS-NOS terminator-Hygromycin resistance
(Plasmid
#246819)
-
PurposeA GreenGate entry vector containing SV40 NLS and Rex NLS followed by a Hygromycin resistance expression cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGGF000
- Backbone size w/o insert (bp) 2686
-
Vector typeGreenGate cloning entry vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-NOS terminator-Hygromycin resistance
-
SpeciesSynthetic
-
Insert Size (bp)2651
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer atgtgagttagctcactcattaggcac
- 3′ sequencing primer gcaaggcgattaagttgggtaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGGF-NLS-NOS terminator-Hygromycin resistance was a gift from Danhua Jiang (Addgene plasmid # 246819 ; http://n2t.net/addgene:246819 ; RRID:Addgene_246819)