pET-C5
(Plasmid
#246823)
-
PurposeExpression plasmid for C5 protein of E. coli RNase P
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Total vector size (bp) 5724
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC5 protein of E. coli RNase P
-
Alt namernpA
-
SpeciesE. coli
-
Insert Size (bp)384
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- Histidine tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcgtccggcgtagaggatc
- 3′ sequencing primer tccggatatagttcctcctttcag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was originally constructed in Fukunaga et al. (2006) and provided by Prof. Yokogawa, T.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When using this plasmid, please also cite the original paper:
Fukunaga J, Gouda M, Umeda K, Ohno S, Yokogawa T, Nishikawa K. Use of RNase P for efficient preparation of yeast tRNATyr transcript and its mutants. J Biochem. 2006 Jan;139(1):123-7. doi: 10.1093/jb/mvj005. PMID: 16428327
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-C5 was a gift from Norikazu Ichihashi & Takashi Yokogawa (Addgene plasmid # 246823 ; http://n2t.net/addgene:246823 ; RRID:Addgene_246823) -
For your References section:
Simultaneous in vitro expression of minimal 21 transfer RNAs by tRNA array method. Miyachi R, Masuda K, Shimizu Y, Ichihashi N. Nat Commun. 2025 Aug 26;16(1):7418. doi: 10.1038/s41467-025-62588-y. 10.1038/s41467-025-62588-y PubMed 40858540