Skip to main content

pUC-M1
(Plasmid #246824)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246824 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Total vector size (bp) 2345
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    M1 RNA of E. coli RNase P
  • Alt name
    rnpB
  • Species
    E. coli
  • Insert Size (bp)
    377
  • Promoter T7 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGCGATTAAGTTGGGTAACGCCAG
  • 3′ sequencing primer CCGGCTCGTATGTTGTGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was originally constructed in Fukunaga et al. (2006) and provided by Prof. Yokogawa, T.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When using this plasmid, please also cite the original paper:

Fukunaga J, Gouda M, Umeda K, Ohno S, Yokogawa T, Nishikawa K. Use of RNase P for efficient preparation of yeast tRNATyr transcript and its mutants. J Biochem. 2006 Jan;139(1):123-7. doi: 10.1093/jb/mvj005. PMID: 16428327

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC-M1 was a gift from Norikazu Ichihashi & Takashi Yokogawa (Addgene plasmid # 246824 ; http://n2t.net/addgene:246824 ; RRID:Addgene_246824)
  • For your References section:

    Simultaneous in vitro expression of minimal 21 transfer RNAs by tRNA array method. Miyachi R, Masuda K, Shimizu Y, Ichihashi N. Nat Commun. 2025 Aug 26;16(1):7418. doi: 10.1038/s41467-025-62588-y. 10.1038/s41467-025-62588-y PubMed 40858540