pHR-HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
(Plasmid
#246867)
-
PurposeExpress HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag (M2-1exo-SunTag) for RSV imaging.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8955
- Total vector size (bp) 10605
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
-
SpeciesRSV
-
Insert Size (bp)1649
-
MutationThe RSV M2-1 protein with a C-terminal insertion of a single SunTag copy.
- Promoter SFFV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.26.645422 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag was a gift from Marvin Tanenbaum (Addgene plasmid # 246867 ; http://n2t.net/addgene:246867 ; RRID:Addgene_246867) -
For your References section:
Pre-assembly of biomolecular condensate seeds drives RSV replication. Ratnayake D, Galloux M, Boersma S, Noerenberg M, Sizun C, Sacristan C, Sourimant J, Lakerveld AJ, Gelderloos AT, Apperloo L, Demyanenko Y, Baars MJD, Banerjee R, Dreier B, Furler S, Mazur NI, Bont LJ, Mohammed S, Pluckthun A, Eleouet JF, Kops GJPL, Castello A, van Kasteren PB, Rameix-Welti MA, Tanenbaum ME. Nature. 2026 Jan 28. doi: 10.1038/s41586-025-10071-5. 10.1038/s41586-025-10071-5 PubMed 41606345