DBJS-p2.11
(Plasmid
#246891)
-
PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP1 Nterm.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 8484
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG3BP1 Nterm Guide RNA 1
-
gRNA/shRNA sequenceATTGACCAAAGCAATGGTGA
-
SpeciesH. sapiens (human)
-
Entrez GeneG3BP1 (a.k.a. G3BP, HDH-VIII)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
- 3′ cloning site Unspecified (unknown if destroyed)
- 5′ sequencing primer Unspecified
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DBJS-p2.11 was a gift from David Bartel (Addgene plasmid # 246891 ; http://n2t.net/addgene:246891 ; RRID:Addgene_246891)