Skip to main content

DBJS-p2.11
(Plasmid #246891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246891 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 8484
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G3BP1 Nterm Guide RNA 1
  • gRNA/shRNA sequence
    ATTGACCAAAGCAATGGTGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    G3BP1 (a.k.a. G3BP, HDH-VIII)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)
  • 3′ cloning site Unspecified (unknown if destroyed)
  • 5′ sequencing primer Unspecified
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DBJS-p2.11 was a gift from David Bartel (Addgene plasmid # 246891 ; http://n2t.net/addgene:246891 ; RRID:Addgene_246891)