Skip to main content
Addgene
Open Menu

pmEOS2-C1-ERGIC53
(Plasmid #246916)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246916 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pmEos2-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4719
  • Total vector size (bp) 6207
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ER-Golgi intermediate compartment 53 kDa protein (ERGIC-53)
  • Alt name
    ER-Golgi intermediate compartment 53 kDa protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • GenBank ID
    U09716
  • Entrez Gene
    LMAN1 (a.k.a. ERGIC-53, ERGIC53, F5F8D, FMFD1, MCFD1, MR60, gp58)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEos at N-terminal (N terminal on insert) (N terminal on backbone)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer 5’ CTTGAAGGAAATGCCCATTACC 3’
  • 3′ sequencing primer 5’ GAAATTTGTGATGCTATTGC 3’
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid was cloned at The Protein Expression Facility (PEF) at The University of Queensland

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ERGIC-53 was PCR amplified from pMXs-IP spGFP-ERGIC53, adding 5-and 3’ extensions for homologous recombination In-Fusion cloning. These sites were then used to insert the ERGIC-53 PCR product into the Xho/Bam digested pmEos2-C1 vector.

Please visit https://doi.org/10.1101/2023.12.31.573799 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEOS2-C1-ERGIC53 was a gift from Merja Joensuu (Addgene plasmid # 246916 ; http://n2t.net/addgene:246916 ; RRID:Addgene_246916)

  • For your References section:

    DDHD2 provides a flux of saturated fatty acids for neuronal energy and function. Saber SH, Yak N, Yong XLH, Bong YT, Leeson H, Dai CY, Binder T, Lu S, Purushothaman R, Lenaerts AS, Almeida-Souza L, Koludarova L, Er S, Hlushchuk I, Gaudin A, Singh S, Nyman TA, Harmer JR, Zuryn S, Wolvetang E, Talbo GH, Airavaara M, Battersby BJ, van Waardenberg AJ, Anggono V, Balistreri G, Joensuu M. Nat Metab. 2025 Oct;7(10):2117-2141. doi: 10.1038/s42255-025-01367-x. Epub 2025 Sep 30. 10.1038/s42255-025-01367-x PubMed 41028912
Related items: