pFBDMchmTet1CD (pc2859)
(Plasmid
#246925)
-
PurposeExpresses mCherry-tagged catalytic active domain of mouse Tet1 in mammalian cells. N-terminal tagged to mCherry.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4772
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet1
-
SpeciesM. musculus (mouse)
-
Mutationaa 1365-2057
-
Entrez GeneTet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
- Promoter Polyhedrin Promoter
-
Tag
/ Fusion Protein
- mcherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTGAGCAAGGGCGAGGAGGATAACATGGCCATCAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBDMchmTet1CD (pc2859) was a gift from Cristina Cardoso (Addgene plasmid # 246925 ; http://n2t.net/addgene:246925 ; RRID:Addgene_246925) -
For your References section:
Binding of MBD proteins to DNA blocks Tet1 function thereby modulating transcriptional noise. Ludwig AK, Zhang P, Hastert FD, Meyer S, Rausch C, Herce HD, Muller U, Lehmkuhl A, Hellmann I, Trummer C, Storm C, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2017 Mar 17;45(5):2438-2457. doi: 10.1093/nar/gkw1197. 10.1093/nar/gkw1197 PubMed 27923996