pHIVT9-NAT-3xFlag-SMARCAL1-ΔN
(Plasmid
#246936)
-
PurposeLentiviral vector that expresses Flag-tagged SMARCAL1 with a deletion of the RPA-binding domain located in the N-terminal region (ΔN)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHIVT9-NAT-3xFlag
- Backbone size w/o insert (bp) 7859
- Total vector size (bp) 10625
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNourseothricin (clonNAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMARCAL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2766
-
Entrez GeneSMARCAL1 (a.k.a. HARP, HHARP)
- Promoter EF-1-alpha promoter
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcttggcacttgatgtaattctcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIVT9-NAT-3xFlag-SMARCAL1-ΔN was a gift from Daniel Durocher (Addgene plasmid # 246936 ; http://n2t.net/addgene:246936 ; RRID:Addgene_246936) -
For your References section:
Profound synthetic lethality between SMARCAL1 and FANCM. Feng S, Liu K, Shang J, Hoeg L, Pastore G, Yang W, Roy S, Sastre-Moreno G, Young JTF, Wu W, Xu D, Durocher D. Mol Cell. 2024 Dec 5;84(23):4522-4537.e7. doi: 10.1016/j.molcel.2024.10.016. Epub 2024 Nov 6. 10.1016/j.molcel.2024.10.016 PubMed 39510066