pET-28a(+)-His-ShadowG-iLID
(Plasmid
#246942)
-
PurposeExpresses His-ShadowG-iLID in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiLiD
-
SpeciesSynthetic
-
Insert Size (bp)1209
-
Tag
/ Fusion Protein
- His-tag and ShadowG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cactataggggaattgtgagcggataa
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a(+)-His-ShadowG-iLID was a gift from Makito Miyazaki (Addgene plasmid # 246942 ; http://n2t.net/addgene:246942 ; RRID:Addgene_246942) -
For your References section:
Optogenetic actin network assembly on lipid bilayer uncovers the network density-dependent functions of actin-binding proteins. Yamamoto K, Miyazaki M. Nat Commun. 2025 Aug 26;16(1):7583. doi: 10.1038/s41467-025-62653-6. 10.1038/s41467-025-62653-6 PubMed 40858537