pUC18T-mini-Tn7T-Gm-CC
(Plasmid #246943)

• Purpose: Plasmid strain containing pUC18T-mini-Tn7T-Gm-CC01 plasmid, which will insert a nonsense spacer version of the synthetic CRISPR-Cas system from P. aeruginosa PA14 into the genome at the att-Tn7 site.
• Depositing Lab: Tiffany Taylor
• Publication: Elliott et al Philos Trans R Soc Lond B Biol Sci. 2025 Sep 4;380(1934):20240473. doi: 10.1098/rstb.2024.0473. Epub 2025 Sep 4.

Backbone

• Vector backbone: pUC18T-mini-Tn7T-Gm
• Backbone manufacturer: Herbert Schweizer (Addgene #63121)
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 13652
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Gentamicin, 100 & 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Type IF CRISPR-Cas system from Pseudomonas aeruginosa PA14
• Alt name: CRISPR-Cas array 2 + native promoter + Cas 1f + Cas3/Cas23f + Csy1/Cas8f + Csy2/Cas5f + Csy3/Cas7f + Csy4/Cas6f
• Species: Pseudomonas aeruginosa PA14
• Insert Size (bp): 8600
• Promoter: Native promoters from PA14

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: cagagcgcttttgaagctaattc (binds to Tn7 backbone just before SpeI)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CRISPR-Cas insert sequence was synthesised by GeneArt.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Synthetic Type IF CRISPR-Cas system based on the sequence from Pseudomonas aeruginosa PA14 with a minimised version of the CRISPR 2 array containing a non-targeting spacer with BbsI restriction sites for cloning. Native promoter regions were cloned as the intergenic region between the CRISPR components and upstream genes. MluI, NsiI, NotI, NcoI, AscI restriction sites were added to make the system modular.