pFRT-B-GPCNA (pc1274)
(Plasmid
#247001)
-
PurposeThis pFRT-B plasmid enables the creation of a stable mammalian cell line expressing GFP-tagged PCNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFRT-lacZeo
- Total vector size (bp) 6751
-
Vector typeCre/Lox
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePCNA
-
SpeciesH. sapiens (human)
-
Entrez GenePCNA (a.k.a. ATLD2)
- Promoter T7
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFRT-B-GPCNA (pc1274) was a gift from Cristina Cardoso (Addgene plasmid # 247001 ; http://n2t.net/addgene:247001 ; RRID:Addgene_247001) -
For your References section:
4D Visualization of replication foci in mammalian cells corresponding to individual replicons. Chagin VO, Casas-Delucchi CS, Reinhart M, Schermelleh L, Markaki Y, Maiser A, Bolius JJ, Bensimon A, Fillies M, Domaing P, Rozanov YM, Leonhardt H, Cardoso MC. Nat Commun. 2016 Apr 7;7:11231. doi: 10.1038/ncomms11231. 10.1038/ncomms11231 PubMed 27052570