pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
(Plasmid
#247049)
-
PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous arm
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCR4-Shh::lacZ-H11
-
Backbone manufacturerLen Pennacchio, Addgene plasmid #139098
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlutathione S-Transferase Alpha 2
-
Alt nameGsta2
-
Alt nameGst2
-
Alt nameGsta2-2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6282
-
GenBank IDNM_008182.3
-
Entrez GeneGsta2 (a.k.a. Gst2-2, Gstc-2, Gstc2)
Cloning Information
- Cloning method Other
- 5′ sequencing primer tgtctctccaaatcgtggcatatgtaactt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP was a gift from Andrew McMahon (Addgene plasmid # 247049 ; http://n2t.net/addgene:247049 ; RRID:Addgene_247049) -
For your References section:
Enhanced Expression of the Female-Biased Gene Gsta2 in Male Proximal Tubule Cells Improves Renal Resilience to Ischemia-Reperfusion Injury. Cheng SY, Guo J, Simonian TL, Caldarelli P, McMahon AP. J Am Soc Nephrol. 2025 Aug 21. doi: 10.1681/ASN.0000000840. 10.1681/ASN.0000000840 PubMed 40839384