pLEXm-hCD45d
(Plasmid #247052)

• Purpose: For mammalian expression of human CD45 domains 1 and 2 with C-terminal Maltose-Binding Protein fusion for secretion into the medium
• Depositing Lab: Omer Dushek
• Publication: Vankayala et al Bioconjug Chem. 2026 Feb 18;37(2):281-292. doi: 10.1021/acs.bioconjchem.5c00519. Epub 2026 Jan 24.

Backbone

• Vector backbone: pLEXm
• Backbone manufacturer: First described in A.R. Aricescu et al. Acta Crystallogr D Biol Crystallogr. (2006)
• Backbone size w/o insert (bp): 4506
• Total vector size (bp): 6267
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hCD45d1d2-MBP
• Species: H. sapiens (human)
• Insert Size (bp): 1761
• Mutation: Domains 1 and 2 only, corresponding to residues 223-392 of UniProtKB accession number P08575
• Promoter: chick β-actin promoter
• Tags / Fusion Proteins:
  • Maltose binding protein (MBP) (C terminal on insert)
  • His6 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pLEX-1679F (CAACGTGCTGGTTGTTGTGCTG)
• 3′ sequencing primer: pLEX-1843R (ACCACCTTCTGATAGGCAGCCT)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Original pLEXm-CD45d1d2 was a kind gift from Simon Davis and previously described in Chang et al., 2016 (https://doi.org/10.1038/ni.3392)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry