pEGRPA 70 (pc502)
(Plasmid
#247053)
-
PurposeExpresses GFP-tagged human RPA70 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEhNt
- Total vector size (bp) 7569
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPA70
-
SpeciesH. sapiens (human)
-
Entrez GeneRPA1 (a.k.a. HSSB, MST075, PFBMFT6, REPA1, RF-A, RP-A, RPA70)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (destroyed during cloning)
- 3′ cloning site XmaI (destroyed during cloning)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGRPA 70 (pc502) was a gift from Cristina Cardoso (Addgene plasmid # 247053 ; http://n2t.net/addgene:247053 ; RRID:Addgene_247053) -
For your References section:
Systematic analysis of DNA damage induction and DNA repair pathway activation by continuous wave visible light laser micro-irradiation. Muster B, Rapp A, Cardoso MC. AIMS Genet. 2017 Feb 21;4(1):47-68. doi: 10.3934/genet.2017.1.47. eCollection 2017. 10.3934/genet.2017.1.47 PubMed 31435503