Skip to main content

pEGRPA 70 (pc502)
(Plasmid #247053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247053 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEhNt
  • Total vector size (bp) 7569
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RPA70
  • Species
    H. sapiens (human)
  • Entrez Gene
    RPA1 (a.k.a. HSSB, MST075, PFBMFT6, REPA1, RF-A, RP-A, RPA70)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (destroyed during cloning)
  • 3′ cloning site XmaI (destroyed during cloning)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGRPA 70 (pc502) was a gift from Cristina Cardoso (Addgene plasmid # 247053 ; http://n2t.net/addgene:247053 ; RRID:Addgene_247053)
  • For your References section:

    Systematic analysis of DNA damage induction and DNA repair pathway activation by continuous wave visible light laser micro-irradiation. Muster B, Rapp A, Cardoso MC. AIMS Genet. 2017 Feb 21;4(1):47-68. doi: 10.3934/genet.2017.1.47. eCollection 2017. 10.3934/genet.2017.1.47 PubMed 31435503