pEGFP-C3-PolB (pc2455)
(Plasmid
#247055)
-
PurposeExpresses GFP-tagged human PolB1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5832
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePolB
-
SpeciesH. sapiens (human)
-
Entrez GenePOLB
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PspOMI (destroyed during cloning)
- 3′ cloning site PspOMI (destroyed during cloning)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C3-PolB (pc2455) was a gift from Cristina Cardoso (Addgene plasmid # 247055 ; http://n2t.net/addgene:247055 ; RRID:Addgene_247055) -
For your References section:
Systematic analysis of DNA damage induction and DNA repair pathway activation by continuous wave visible light laser micro-irradiation. Muster B, Rapp A, Cardoso MC. AIMS Genet. 2017 Feb 21;4(1):47-68. doi: 10.3934/genet.2017.1.47. eCollection 2017. 10.3934/genet.2017.1.47 PubMed 31435503