pCDF-cascade
(Plasmid
#247069)
-
PurposeL-arabinose inducible E.coli cascade operon inserted in pCDF vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDF
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 7857
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE.coli Type I-E CRISPR cas
-
Alt namecascade
-
Alt nameCasA-E
-
SpeciesEscherichia coli K-12 W3110
- Promoter araBAD promoter
Cloning Information
- Cloning method Other
- 5′ sequencing primer gagctaacttacattaattgcgttg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF-cascade was a gift from Seokhee Kim (Addgene plasmid # 247069 ; http://n2t.net/addgene:247069 ; RRID:Addgene_247069)