pMut20_tadDE32B
(Plasmid
#247074)
-
PurposeL-arabinose inducible TadDE-XTEN32-CasB(Cas11)-GSSG-UGI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 5300
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTadDE-XTEN16-CasB-UGI
-
Alt nameTadDE
-
Alt nameCasB
-
Alt nameUGI
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGCCATAGCATTTTTATCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMut20_tadDE32B was a gift from Seokhee Kim (Addgene plasmid # 247074 ; http://n2t.net/addgene:247074 ; RRID:Addgene_247074)