His-AA1-245-GFP
(Plasmid
#247240)
-
PurposeA bacterial expression plasmid encoding Arl13b (aa1-245) with N-terminal His and GFP-tagged
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET30ax
-
Backbone manufacturerLu Lab (Madugula et al J Cell Sci. 2016)
- Backbone size w/o insert (bp) 5406
- Total vector size (bp) 6074
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArl13B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)703
-
Mutationdeleted amino acids 246-428
-
Entrez GeneARL13B (a.k.a. ARL2L1, JBTS8)
- Promoter t7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-AA1-245-GFP was a gift from Lei Lu (Addgene plasmid # 247240 ; http://n2t.net/addgene:247240 ; RRID:Addgene_247240) -
For your References section:
Rab8 and TNPO1 are ciliary transport adaptors for GTPase Arl13b by interacting with its RVEP motif containing ciliary targeting sequence. Mahajan D, Madugula V, Lu L. J Biol Chem. 2023 May;299(5):104604. doi: 10.1016/j.jbc.2023.104604. Epub 2023 Mar 11. 10.1016/j.jbc.2023.104604 PubMed 36907439