Skip to main content

His-AA1-245-GFP
(Plasmid #247240)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247240 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET30ax
  • Backbone manufacturer
    Lu Lab (Madugula et al J Cell Sci. 2016)
  • Backbone size w/o insert (bp) 5406
  • Total vector size (bp) 6074
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Arl13B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    703
  • Mutation
    deleted amino acids 246-428
  • Entrez Gene
    ARL13B (a.k.a. ARL2L1, JBTS8)
  • Promoter t7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His-AA1-245-GFP was a gift from Lei Lu (Addgene plasmid # 247240 ; http://n2t.net/addgene:247240 ; RRID:Addgene_247240)
  • For your References section:

    Rab8 and TNPO1 are ciliary transport adaptors for GTPase Arl13b by interacting with its RVEP motif containing ciliary targeting sequence. Mahajan D, Madugula V, Lu L. J Biol Chem. 2023 May;299(5):104604. doi: 10.1016/j.jbc.2023.104604. Epub 2023 Mar 11. 10.1016/j.jbc.2023.104604 PubMed 36907439