Skip to main content

p7VP1
(Plasmid #24726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24726 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGwf
  • Backbone manufacturer
    Christopher Buck lab, Addgene plasmid 22517
  • Backbone size w/o insert (bp) 5388
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP1 from Human Polyomavirus 7
  • Species
    polyomavirus
  • Insert Size (bp)
    1143

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR1 (destroyed during cloning)
  • 3′ cloning site attR2 (destroyed during cloning)
  • 5′ sequencing primer 1179R (TCCATTTCAGGTGTCGTGAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p7VP1 was a gift from Christopher Buck (Addgene plasmid # 24726 ; http://n2t.net/addgene:24726 ; RRID:Addgene_24726)
  • For your References section:

    Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254