p7VP1
(Plasmid
#24726)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 24726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGwf
-
Backbone manufacturerChristopher Buck lab, Addgene plasmid 22517
- Backbone size w/o insert (bp) 5388
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVP1 from Human Polyomavirus 7
-
Speciespolyomavirus
-
Insert Size (bp)1143
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR1 (destroyed during cloning)
- 3′ cloning site attR2 (destroyed during cloning)
- 5′ sequencing primer 1179R (TCCATTTCAGGTGTCGTGAG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p7VP1 was a gift from Christopher Buck (Addgene plasmid # 24726 ; http://n2t.net/addgene:24726 ; RRID:Addgene_24726) -
For your References section:
Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254