pLN053
(Plasmid
#247313)
-
PurposeExpression of PopZ fused to mCherry and sfGFP under the control of the PopZ promoter (KanR)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXYFPN
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePopZ
-
SpeciesCaulobacter crescentus
-
Entrez GenepopZ (a.k.a. CCNA_01380)
- Promoter PPopZ
-
Tags
/ Fusion Proteins
- sfgfp (N terminal on insert)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggtgagcaagggcgaggagg
- 3′ sequencing primer ctcggggacgcggcgcctaa
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pXYFPN-2-PPopZ-mCherry-sfGFP-PopZ
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLN053 was a gift from Wei Zhao (Addgene plasmid # 247313 ; http://n2t.net/addgene:247313 ; RRID:Addgene_247313) -
For your References section:
Scaffold-Scaffold Interaction Facilitates Cell Polarity Development in Caulobacter crescentus. Lu N, Duvall SW, Zhao G, Kowallis KA, Zhang C, Tan W, Sun J, Petitjean HN, Tomares DT, Zhao GP, Childers WS, Zhao W. mBio. 2023 Apr 25;14(2):e0321822. doi: 10.1128/mbio.03218-22. Epub 2023 Mar 27. 10.1128/mbio.03218-22 PubMed 36971555