pNarsenic_noProm
(Plasmid
#247321)
-
PurposeControl plasmid for pNarsenic lacking the ArsR-regulated promoter upstream of the reporter gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTwist+Kan+High
-
Backbone manufacturerTwist Bioscience
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namefdeR
-
SpeciesHerbaspirillum seropedicae
-
GenBank IDWP_013233032.1
- Promoter P_fdeR
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAGTGCCATTCCGCCTGAC
- 3′ sequencing primer GTGGTTATTCACGGTGCCTTCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemkate2
-
SpeciesSynthetic
- Promoter None
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TCACCAACCTCACTTACTCC
- 3′ sequencing primer CACTGAGCCTCCACCTAGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameArsenical resistance operon repressor
-
Alt namearsR
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
GenBank IDGCF_000005845.2
- Promoter P_fdeA
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAGCCTGGCCATGACAACG
- 3′ sequencing primer GAAGTGCCATTCCGCCTGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNarsenic_noProm was a gift from Eveline Peeters (Addgene plasmid # 247321 ; http://n2t.net/addgene:247321 ; RRID:Addgene_247321) -
For your References section:
Development and characterization of pNarsenic: a naringenin-inducible biosensor for arsenic in Escherichia coli. Crabbe V, Unal E, De Graeve S, Guerra DG, Peeters T, de Buyl S, Peeters E, Bervoets I. Synth Biol (Oxf). 2026 Jan 10;11(1):ysag001. doi: 10.1093/synbio/ysag001. eCollection 2026. 10.1093/synbio/ysag001 PubMed 41608477