Skip to main content

AAV-Nppa-EGFP
(Plasmid #247327)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247327 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    AAV
  • Total vector size (bp) 4840
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP under the control of the Nppa Promoter
  • Species
    Synthetic
  • Promoter Nppa proximal promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgtagttaatgattaacccgccatg
  • 3′ sequencing primer tcgggtaccttatctagatccgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was a gift from Dr. William Pu's lab at Boston Children's Hospital.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Nppa-EGFP was a gift from William Pu & Mason Sweat (Addgene plasmid # 247327 ; http://n2t.net/addgene:247327 ; RRID:Addgene_247327)
  • For your References section:

    Tbx5 maintains atrial identity in post-natal cardiomyocytes by regulating an atrial-specific enhancer network. Sweat ME, Cao Y, Zhang X, Burnicka-Turek O, Perez-Cervantes C, Arulsamy K, Lu F, Keating EM, Akerberg BN, Ma Q, Wakimoto H, Gorham JM, Hill LD, Kyoung Song M, Trembley MA, Wang P, Gianeselli M, Prondzynski M, Bortolin RH, Bezzerides VJ, Chen K, Seidman JG, Seidman CE, Moskowitz IP, Pu WT. Nat Cardiovasc Res. 2023 Oct;2(10):881-898. doi: 10.1038/s44161-023-00334-7. Epub 2023 Oct 12. 10.1038/s44161-023-00334-7 PubMed 38344303