AAV-Nppa-Cre-P2A-TagRFP
(Plasmid
#247328)
-
PurposeExpresses Cre and TagRFP under the control of the Nppa promoter.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
- Total vector size (bp) 5853
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre-P2A-TagRFP
-
SpeciesSynthetic
-
Insert Size (bp)1817
- Promoter Nppa proximal promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtagttaatgattaacccgccatg
- 3′ sequencing primer agaagtcagatgctcaaggggc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was a gift from Dr. William Pu's lab at Boston Children's Hospital.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Nppa-Cre-P2A-TagRFP was a gift from William Pu & Mason Sweat (Addgene plasmid # 247328 ; http://n2t.net/addgene:247328 ; RRID:Addgene_247328) -
For your References section:
Tbx5 maintains atrial identity in post-natal cardiomyocytes by regulating an atrial-specific enhancer network. Sweat ME, Cao Y, Zhang X, Burnicka-Turek O, Perez-Cervantes C, Arulsamy K, Lu F, Keating EM, Akerberg BN, Ma Q, Wakimoto H, Gorham JM, Hill LD, Kyoung Song M, Trembley MA, Wang P, Gianeselli M, Prondzynski M, Bortolin RH, Bezzerides VJ, Chen K, Seidman JG, Seidman CE, Moskowitz IP, Pu WT. Nat Cardiovasc Res. 2023 Oct;2(10):881-898. doi: 10.1038/s44161-023-00334-7. Epub 2023 Oct 12. 10.1038/s44161-023-00334-7 PubMed 38344303