pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT
(Plasmid
#247342)
-
PurposeFLP/FRT based mammalian expression vector for mouse histone H3.1-EGFP, driven by mouse histone H3.1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF5
-
Backbone manufacturerInvitrogen, Cat#V602020
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH3.1 (H3C10)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1152
-
Entrez GeneH3c10 (a.k.a. H3-291, H3c1, H3c11, H3c8, Hist1h3h)
- Promoter mH3.1p
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer aagctacaacaaggcaaggc
- 3′ sequencing primer M13-Rv
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT was a gift from Kazuhiro Maeshima (Addgene plasmid # 247342 ; http://n2t.net/addgene:247342 ; RRID:Addgene_247342) -
For your References section:
Density imaging of heterochromatin in live cells using orientation-independent-DIC microscopy. Imai R, Nozaki T, Tani T, Kaizu K, Hibino K, Ide S, Tamura S, Takahashi K, Shribak M, Maeshima K. Mol Biol Cell. 2017 Nov 7;28(23):3349-3359. doi: 10.1091/mbc.E17-06-0359. Epub 2017 Aug 23. 10.1091/mbc.E17-06-0359 PubMed 28835378