pAAVS-NDi-H1.2_WT-Halo
(Plasmid
#247484)
-
PurposeExpresses H1.2 (WT) by tet-on system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAVS1-Ndi-CRISPRi
-
Backbone manufacturerAddgene, #73498
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH1.2 (HIST1H1C)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1598
-
Entrez GeneH1-2 (a.k.a. H1.2, H1C, H1F2, H1s-1, HIST1H1C)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.05.641622 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS-NDi-H1.2_WT-Halo was a gift from Kazuhiro Maeshima (Addgene plasmid # 247484 ; http://n2t.net/addgene:247484 ; RRID:Addgene_247484) -
For your References section:
Linker histone H1 functions as a liquid-like glue to organize chromatin in living human cells. Shimazoe MA, Huertas J, Phillips C, Ide S, Tamura S, Farr S, Ashwin SS, Sasai M, Collepardo-Guevara R, Maeshima K. Sci Adv. 2026 Apr 10;12(15):eaec9801. doi: 10.1126/sciadv.aec9801. Epub 2026 Apr 8. 10.1126/sciadv.aec9801 PubMed 41950317